ai-agent-book 精选快照(<2MB 代码与文档,来自 github.com/bojieli/ai-agent-book)
Build latest book artifacts / build (push) Canceled after 0s
dependency resolution / resolve (3.11) (push) Canceled after 0s
dependency resolution / resolve (3.13) (push) Canceled after 0s
deploy-pages / build (push) Canceled after 0s
deploy-pages / deploy (push) Canceled after 0s
i18n consistency check / check (push) Canceled after 0s
provider adoption tests / test (chapter2/context-compression) (push) Canceled after 0s
provider adoption tests / test (chapter2/prompt-injection) (push) Canceled after 0s
provider adoption tests / test (chapter2/system-hint) (push) Canceled after 0s
provider adoption tests / test (chapter3/log-sanitization) (push) Canceled after 0s
web-search-agent tests / test (push) Canceled after 0s
web-search-agent tests / agentbook (push) Canceled after 0s

This commit is contained in:
2026-08-20 13:12:50 +00:00
commit b119135836
10275 changed files with 3284984 additions and 0 deletions
@@ -0,0 +1,71 @@
{
"benchmark": "Terminal-Bench",
"operator": "Codex acting as the human operator",
"source_commit": "8384a179b1b8688f6ea5233a4d9d51218df1ac96",
"reference_solution_inspected": false,
"cases": [
{
"tier": "easy",
"task_id": "fix-permissions",
"about": "Diagnose why /app/process_data.sh could not execute and repair it.",
"trajectory": [
"Listed /app and inspected the public script; its mode was 664 (-rw-rw-r--).",
"Ran /app/process_data.sh once and observed Permission denied with exit status 126.",
"Ran chmod +x /app/process_data.sh, producing mode 775 (-rwxrwxr-x).",
"Ran the script and observed Data processed successfully!.",
"Invoked the upstream run-tests.sh evaluator."
],
"official_evaluator": "pytest via upstream run-tests.sh",
"official_tests": {"passed": 1, "failed": 0, "names": ["test_script_permissions"]},
"result": "passed",
"evaluation_explanation": "The missing execute bits were the sole defect. The official test confirmed that the script was executable."
},
{
"tier": "medium",
"task_id": "simple-sheets-put",
"about": "Populate a stateful spreadsheet service through its REST API while creating exactly one spreadsheet.",
"trajectory": [
"Fetched /spreadsheets/ and confirmed the initial total was zero.",
"Fetched /docs/json and identified spreadsheet, sheet, individual-cell, and batch-cell endpoints.",
"Created exactly one spreadsheet titled Financial Report and one sheet titled Q1 Data.",
"Attempted the advertised batch-cell PUT endpoint; it returned HTTP 400 without updating cells.",
"Used the documented individual-cell PUT endpoint for A1:D4.",
"Entered Month, Revenue, Expenses, and Profit headers; January through March data; and computed profits 2000, 3000, and 5000.",
"Fetched the final spreadsheet and sheet state, confirming one spreadsheet and all 16 cells.",
"Invoked the upstream run-tests.sh evaluator."
],
"official_evaluator": "pytest via upstream run-tests.sh",
"official_tests": {"passed": 3, "failed": 0, "names": ["test_spreadsheet_created", "test_sheet_created", "test_cells_created"]},
"result": "passed",
"evaluation_explanation": "All required persistent objects and values were present, and the singleton spreadsheet constraint was preserved despite the failed batch request."
},
{
"tier": "hard",
"task_id": "dna-assembly",
"about": "Design the minimum Golden Gate primer set that assembles a circular backbone, EGFP, FLAG linker, and SNAP into an exact target plasmid.",
"trajectory": [
"Parsed the five supplied FASTA records and confirmed none contained an internal BsaI site.",
"Aligned the target to the templates and inferred EGFP without its stop codon, FLAG without start/stop codons, SNAP without its start codon, and the input plasmid backbone with its prior insert removed.",
"Selected the minimum four primer pairs and junction overhangs ATGA, GGTA, GACA, and TAAT.",
"Simulated the four digested fragments and confirmed their circular assembly exactly matched the 3,591-nt target up to rotation.",
"Installed primer3 and selected annealing tracts using oligotm with -tp 1 -sc 1 -mv 50 -dv 2 -n 0.8 -d 500.",
"Wrote primers.fasta with eight required records and no blank lines.",
"Invoked the upstream run-tests.sh evaluator once; after the terminal failure, did not revise or resubmit."
],
"submitted_primers": {
"input_fwd": "AATGGGTCTCATAATGAGGATCCCGGGAATTCT",
"input_rev": "AATGGGTCTCATCATATGTATATCTCCTTCTTAAAGTTAAACAAA",
"egfp_fwd": "AATGGGTCTCAATGAGCAAGGGCGAGGAGCTG",
"egfp_rev": "AATGGGTCTCATACCTTTGTACAGCTCGTCCATGCC",
"flag_fwd": "AATGGGTCTCAGGTAGTGGCTCCGGTAGCG",
"flag_rev": "AATGGGTCTCATGTCTGAACCACTACCTGAACCAG",
"snap_fwd": "AATGGGTCTCAGACAAAGACTGCGAAATGAAGCGCA",
"snap_rev": "AATGGGTCTCAATTAACCCAGCCCAGGCTTACC"
},
"official_evaluator": "pytest via upstream run-tests.sh",
"official_tests": {"passed": 0, "failed": 1, "names": ["test_primers"]},
"result": "failed",
"evaluation_explanation": "The FLAG forward overhang's four-base suffix also matched the adjacent template, so the evaluator correctly treated it as part of the annealing tract. Its evaluated Tm was 66.056662 C versus 60.610114 C for FLAG reverse, a 5.446548 C gap that violated the at-most-5 C rule. The pre-evaluation calculation had incorrectly measured only the 15-base explicit binding suffix for that primer."
}
]
}